submitted by Steelerfish to Covid1984 2.8 yearsJul 10, 2022 12:57:30 ago (+37/-0) (www.thegatewaypundit.com)
https://www.thegatewaypundit.com/2022/07/must-watch-dr-peter-mccullough-discusses-new-study-shows-pfizers-covid-mrna-vaccines-can-modify-dna-human-genome-video/
[ + ] dassar
[ - ] dassar 0 points 2.8 yearsJul 11, 2022 02:51:27 ago (+0/-0)
Rather have the source material other than from a pozzed homosexual (Hoft)
[ + ] ilikeskittles
[ - ] ilikeskittles 1 point 2.8 yearsJul 10, 2022 19:33:06 ago (+1/-0)
[ + ] Boardallday3
[ - ] Boardallday3 1 point 2.8 yearsJul 10, 2022 21:08:54 ago (+1/-0)
[ + ] GloryBeckons
[ - ] GloryBeckons 3 points 2.8 yearsJul 10, 2022 13:59:41 ago (+3/-0)
https://scitechdaily.com/new-discovery-shows-human-cells-can-write-rna-sequences-into-dna-challenges-central-principle-in-biology/
https://www.science.org/doi/10.1126/sciadv.abf1771
Shared here back then: https://www.voat.xyz/viewpost?postid=6102db2547150
There's no telling what kind of effects this will have across generations. But what is certain is that these changes to the DNA of the afflicted are permanent and irreversible. A mess like this is relatively easy to make, but much more difficult to undo. We simply don't have the technology and potentially never will.
[ + ] oursenilepresident
[ - ] oursenilepresident 5 points 2.8 yearsJul 10, 2022 15:25:04 ago (+5/-0)*
I posted the proven DNA sequence "GACCCCAAAATCAGCGAAAT" from one paper to free speech sites about 1.5 years ago!!!
= = = =
2022: Fauci and the CDC lied: MRNA “vaccines” do convert to DNA, altering the human body’s genome:
https://anonymouswire.com/fauci-and-the-cdc-lied-mrna-vaccines-do-convert-to-dna-altering-the-human-bodys-genome/
Fauci Flu shots do, in fact, alter human DNA permanently
Gearing up for the BIG REVEAL: HHS releases FDA gene editing guidance, may soon admit mRNA COVID shots are actually gene therapy products:
http://geneticlunacy.com/2022-04-01-hhs-releases-fda-gene-editing-guidance.html
https://www.theepochtimes.com/mkt_app/pfizers-covid-19-vaccine-goes-into-liver-cells-and-is-converted-to-dna-study_4307594.html
And now again , 2022.07.09 : New Study That Shows Pfizer’s Covid mRNA Vaccines Can MODIFY DNA in the Human Genome
https://www.thegatewaypundit.com/2022/07/must-watch-dr-peter-mccullough-discusses-new-study-shows-pfizers-covid-mrna-vaccines-can-modify-dna-human-genome-video/
https://archive.ph/8eTGJ
= = = =
Forbes Jew media comedy meme on its media spin :
https://u.smutty.horse/mfnsshihmcu.jpg
The meme is comedy, but it is factual though!
https://archive.fo/QpJk0
https://archive.fo/wHoBf
"GACCCCAAAATCAGCGAAAT" was shown inserted into DNA in Dec 2020 paper, and other papers :
https://files.catbox.moe/mg9m18.pdf
= = =
100% true. You understand it.
[ + ] Leveraction
[ - ] Leveraction 1 point 2.8 yearsJul 10, 2022 15:35:52 ago (+1/-0)
[ + ] dassar
[ - ] dassar 1 point 2.8 yearsJul 11, 2022 02:54:51 ago (+1/-0)
I remember that guy from substack was asking for someone with access to a DNA sequencing lab to do it ....
[ + ] oursenilepresident
[ - ] oursenilepresident 0 points 2.8 yearsJul 12, 2022 23:46:34 ago (+0/-0)*
BELOW IS A REPRINT of one long comment I mde on the nothingbrger snippet, even though it foretold more dire sequences found later on.
= = = = = = = = = = =
BEGIN SNIPPET REPRINT :
= = = = == = = =
amazing paper find.
Big Boy Review Time
======
This was a PREPRINT from 2020 December (December 13, 2020) prior to peer review. Yes it is that old.
https://files.catbox.moe/mg9m18.pdf
The world now conclusively knows their PCR tests they used was erroneously set to Influenza in this paper. CDC even admitted that FACT 2 weeks ago online.
If they did use real SARS-2 sample, however impure, they did show extremely slight viral insertion into DNA, which means it can be immortalized into Human egg cell or sperm cells and become part of every cell of newborn human. Like Viruses for 1,000,000 years inside human DNA, all broken, fragmented, inert, and incapable of escape (hopefully). All mammals have old virus trapped inside your DNA when born, and one day it might be scary as its an "anchor" a second CRISPR-Cas9 virus could piggyback on to melt a human in 40 minutes from "lysing" a whole being one day.
Mammals Carry a Graveyard of Viruses in Our DNA, And It Could Have a Crucial Purpose:
https://www.msn.com/en-au/news/techandscience/mammals-carry-a-graveyard-of-viruses-in-our-dna-and-it-could-have-a-crucial-purpose/ar-AAOli2T
Viruses rarely invade egg cells but as you can see in that link, we know it happens sometimes.
MY SUMMARY
Using amped-up PCR using NOW FRAUDULENT PCR primer source from WHO (Influenza-A and B), this paper got a hyperactive immortal tumor kidney cell from female fetus in 1973 to show SLIGHT viral recombination.
They do however claim 600% higher measurement of "glowing" than control for this claim :
and detected their transcription in the nucleus. SARS-CoV-2 infected cells showed the expected
cytoplasmic FISH signals of N RNA (Fig. S3a).
Keep in mind the length of piece they injected was laughably short and common to many virus species : here it is in full
"GACCCCAAAATCAGCGAAAT"
yup! Thats how many base pairs they inserted and say its reverse of : "TCTGGTTACTGCCAGTTGAATCTG"
A statistician might roll their eyes at that, but they do claim 600% more presence over background control noise, but I bet DNA has methods of shedding some garbage like that, or neutering it by palindromic gibberish fold backs, or blasting it with base pair mutations, or losing it in 'recombination in meiosis' and preferring other side strand gene, or by affixing inhibiting histone body onto the viral interloper to restrict its ability to create proteins. All of my claims are just uplifting wishful thinking, but I'll be fucking damned if I believe evolution has no defense from tiny trivial sequence "GACCCCAAAATCAGCGAAAT" invading human dna and getting free reign that easily!
So in summary, the already very short single strand SARS-2 virus CANNOT lyse out nor be formed from copies entombed into DNA, but SMALL pernicious common Virus parts ARE slightly sometimes in VERY SMALL FRAGMENTS inserted into DNA of cells and reproduced, and one day shed from apoptosis (normal cell death).
This article, if rewritten, would have to use the new Post Dec 21st 2021 CDC Isolate of SARS-2, would have to also use three PCR test references to eliminate Influenza-A and Influenza-B. HIV is expected too as it has 4 copies on the tiny short SARS-2 Wuhan man-made bioweapon research virus. 4 copies!!!
I propose they had contamination of Influenza-A and B that they tagged and inserted and measured back, and they ADMITTED they only got tiny fragment pieces inserted into human DNA... and very very abnormal IMMORTAL DNA with provably 100s of anomalies since 1973.
This paper is trying to explain why 94% of humans now in 2021 show ANTIBODIES for SARS-2 and PCR results for SARS-2. In Dec 2020 it would have been 45% of westerners.
We now know the answer is proven that though SARS-2 is real (in a computer file) and was real though a shitty virus (in Wuhan), the vast majority of SARS-2 so-called positive people are now proven to be merely survivors of Influenza of unknown prior seasons.
TL/DR: It is alarming that their test sample could measurably (above noise error rate) invade a highly abnormal human cell line, but in this old paper they did not eliminate Influenza , did not get more than a broken tiny piece inserted, did not use proper real SARS-2 isolate, did not use current August 2021 rules for PCR of SARS-2 lines.
= = = = = =
END SNIP
[ + ] dassar
[ - ] dassar 0 points 2.8 yearsJul 13, 2022 04:25:49 ago (+0/-0)
What is the sequence from ?
Is it naturally occurring ??
Do people already have this floating around in them??
Has it been inserted into the holo-cov virus and or jab so anyone (with the holo-cov as well as others) that already carries it, can be classified as holo-cov positive ??
Can this sequence be used as a future vector in collaboration with other m-RNA Gene based therapies ??
[ + ] Neral
[ - ] Neral 3 points 2.8 yearsJul 10, 2022 15:54:28 ago (+3/-0)
[ + ] totes_magotes
[ - ] totes_magotes 5 points 2.8 yearsJul 10, 2022 15:17:14 ago (+5/-0)
[ + ] Steelerfish
[ - ] Steelerfish [op] 4 points 2.8 yearsJul 10, 2022 15:40:54 ago (+4/-0)
[ + ] Clubberlang
[ - ] Clubberlang 1 point 2.8 yearsJul 10, 2022 21:20:38 ago (+1/-0)
[ + ] UncleDoug
[ - ] UncleDoug 8 points 2.8 yearsJul 10, 2022 13:57:36 ago (+8/-0)
[ + ] ItsOk2bArian
[ - ] ItsOk2bArian 2 points 2.8 yearsJul 11, 2022 00:12:49 ago (+2/-0)